Classification
Within iNaturalist.org

All Names

  • Scientific Names
    • Pleurotus
  • Spanish
    • Setas
  • Chinese (Traditional)
    • 側耳屬

Extras

Taxonomic changes »

Taxon schemes »

Make taxonomic Flickr tags for this taxon »

Invite photos from other sites »

Wikipedia taxobox »

Search descendant taxa »

Embed a widget for this taxon on your website »

245561831 fea5bfaef9 s 245561831 fea5bfaef9 s 19262203 b51e010221 s 5920211404 c3e93a44a5 s 5033117576 e1302d6ff9 s 19262231 92fe286d7c s 8180392161 6cf3677e9f s 75px pleurotus nebrodensis 4503054062 1e099aa00d s 6506829827 b69c902b69 s 6506829333 3b82772d40 s 6506828713 15456ff824 s 1520032381 abc09be35f s 19216460702 a2090c837d s 12955939465 b74434b215 s 11972695833 2b067291aa s 3081673097 fdd28f482d s 3082513124 1c0db148a3 s 3545290968 6f1e70c0c6 s Square Square Square 13569 98 68 Square
Creative Commons Flickr Photos Tagged "Pleurotus."

Recent observations

Photos / Sounds

Square

What

Oyster Mushroom Pleurotus ostreatus

Observer

gbentall

Date

December 9, 2016 04:19 PM PST

Photos / Sounds

Observer

alan_rockefeller

Date

August 30, 2016

Description

On conifer.

Photos / Sounds

Observer

alan_rockefeller

Date

August 30, 2016

Description

On conifer.

Photos / Sounds

No photos or sounds

Observer

alan_rockefeller

Date

October 26, 2015

Photos / Sounds

No photos or sounds

Observer

alan_rockefeller

Date

October 26, 2015

Photos / Sounds

No photos or sounds

Observer

alan_rockefeller

Date

October 26, 2015

Photos / Sounds

No photos or sounds

Observer

alan_rockefeller

Date

October 26, 2015

Photos / Sounds

No photos or sounds

Observer

alan_rockefeller

Date

October 26, 2015

Photos / Sounds

No photos or sounds

Observer

alan_rockefeller

Date

October 26, 2015

Photos / Sounds

No photos or sounds

Observer

alan_rockefeller

Date

October 26, 2015

Photos / Sounds

Observer

alan_rockefeller

Date

August 1, 2014

Place

Morocco (Google, OSM)

Description

Ava Arvest collection. Cultivated from a collection from Morocco. This species is unusually widespread.

ITS sequence: CTATGGAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACCTGTGAACTTT

TGATAGATCTGTGAAGTCGTCCTTCAAGTCGTCAGACTTGGTTTGCTGGGATTTAAACGTCTCGGTGTGA

CAACGCAGTCTATTTACTTAACACACCCCAAATGTATGTCTACGAATGTCATTTAATGGGCCTTGTGCCT

ATAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGC

GATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT

TCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTCACATTTATTTGTGATGTTTGGATTGT

TGGGGGTTGCTGGCTGTAACAAGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGC

ATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTCCAGCTCTCTAATCGTCCGCAAGGA

CAATTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

AAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG

GTCTTTGGCCATCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTAC

Photos / Sounds

Observer

alan_rockefeller

Date

August 1, 2014

Place

Morocco (Google, OSM)

Description

Ava Arvest collection. Cultivated from a collection from Morocco. This species is unusually widespread.

ITS sequence: CTATGGAGTTGTTGCTGGCCTCTAGGGGCATGTGCACGCTTCACTAGTCTTTCAACCACCTGTGAACTTT

TGATAGATCTGTGAAGTCGTCCTTCAAGTCGTCAGACTTGGTTTGCTGGGATTTAAACGTCTCGGTGTGA

CAACGCAGTCTATTTACTTAACACACCCCAAATGTATGTCTACGAATGTCATTTAATGGGCCTTGTGCCT

ATAAACCATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGC

GATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTAT

TCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAAACTCACATTTATTTGTGATGTTTGGATTGT

TGGGGGTTGCTGGCTGTAACAAGTCGGCTCCTCTTAAATGCATTAGCAGGACTTCTCATTGCCTCTGCGC

ATGATGTGATAATTATCACTCATCAATAGCACGCATGAATAGAGTCCAGCTCTCTAATCGTCCGCAAGGA

CAATTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

AAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTG

GTCTTTGGCCATCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTAC

View all observations

Description from Wikipedia

Pleurotus is a genus of gilled mushrooms which includes one of the most widely eaten mushrooms, P. ostreatus. Species of Pleurotus may be called oyster, abalone, or tree mushrooms, and are some of the most commonly cultivated edible mushrooms in the world.Pleurotus fungi have been used in mycoremediation of pollutants such as petroleum and polycyclic aromatic hydrocarbons.

No range data available.
Member of the iNaturalist Network   |   Powered by iNaturalist open source software