mythical_mold's Favorites

Norway spruce cone
NCBI BLAST

CATTATTGAACTTTGAACACTTTGTACTCTTGTCTGTTGCTGGCTTCTTCGGAAGTATGTGCACGCTTGAGTGCAAGGGTCTTCTTTGTCCACCTGTGCACCTTTTGTAGATCTGGATACCTCTCGCCTTACCCAAGGCGGATTTTGAAGGGTTGCTACTTCGTAGCTCCCTTTGTTTTCCAGGTCTATGTCTTATATCATCTCAAGTATGTTTAGAATGTCTTGTTTATTGGACTCTGTCCTTTAAAAACTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCAGTAAATTCTCAACCCCTCTCACTTTGTTGTGACGAGGTGGATTGGATGTGGAGGTTGCTGGACGCTTTATTGCGATCAGCTCTTCTGAAATGTATTAGCAGTAGTACCATTACTTGGCTTGCTAAGCTTGTGATAATATCTCTAGCTTGCTCGCTGGGTAGAGTTCGGGTTTGAAGGGTTGCTTTAACGAGCTCTCTTTGCCTTCTCTCTTTCGAGGGAGATAACTATGCGACTCTACTAGATGGCTTCAGCTTCTAACCGTCTGTAACAAGACAATACAACTGACTATTTGACCTCAAATCAGG

The Strobilurus albipilatus was: Strobilurus esculentus or occidentalis
(it could have been albipilatus) as it matched closely with the three species listed above. However it matched 100% with Strobilurus esculentus

20m+ depth. ID placeholder as I have no images of spicules. I'll withdraw if it should be be placed in a higher-level taxon. Stars uploaded as separate observations:
https://www.inaturalist.org/observations/105496844
https://www.inaturalist.org/observations/105496842

This observation is part of a long-term project examining plankton biodiversity in the nearshore waters around the Hakai Institute's Quadra Island ecological observatory. A COI DNA sequence from the organism has been deposited in the Barcode of Life Data System (BOLD). Photo license and credit belong to the Hakai Institute.

This might be a stretch but the Jerry Shine book suggests Okenia ascidicola. "Loosely curled capsules, thinner than a standard pencil and packed with eggs."

http://www.seaslugforum.net/find/11689

Maybe Onchidoris muricata
https://www.inaturalist.org/taxa/47508-Onchidoris-muricata/browse_photos

These are all images of the same individual - good example of the ability to rapidly change color/pattern. You'll also notice a small wound on the tentacles and a larger lesion on the right side of the mantle.

This observation documents the collection of a sample of Phellopsylla, on behalf of Martoni F. (@f_martoni), who suspected the Phellopsylla I previously observed at this location may represent an undescribed species.

The foliage of a cultivated, juvenile Corymbia maculata tree (Melbourne Urban Forest ID no. 1734536; image 2) was inspected, and individuals were brushed off into a vial of pure ethanol for euthanasia. Adults were typically found singly on leaves, or as a copulating pair. Lerps on stems (image 3) were lifted to collect nymphs of varying developmental stages. This sample was examined under a stereomicroscope at 8 x magnification (image 1) to remove by-catch. Fifteen adult females, nine adult males, and seven nymphs were collected, for a total of 31 individuals. These were returned to pure ethanol for preservation, in a vial labelled "1" (image 4), to be sent to Martoni in conjunction with a vial labelled "2".

This observation documents the collection of a sample of Agelaeopsylla, on behalf of Martoni F. (@f_martoni), who suspected the Agelaeopsylla I previously observed at this location (observation no. 98154858) may represent an undescribed species.

The foliage of a cultivated, juvenile Corymbia maculata tree (Melbourne Urban Forest ID no. 1734536; image 2) was inspected, and individuals were brushed off into a vial of pure ethanol for euthanasia. Adults were typically found singly on leaves. This sample was examined under a stereomicroscope at 10 x magnification (image 1) to remove by-catch. A total of 17 adults were collected. These were returned to pure ethanol for preservation, in a vial labelled "2" (image 3), to be sent to Martoni in conjunction with a vial labelled "1".

Often attaches by tip of posterior flagellum and has a distinctive kicking or bouncing movement. Genus was narrowed around this species, most other accepted species went to the related Neobodo. And despite what iNaturalist asserts, this is NOT a euglenoid, but a kinetoplastid (i.e. on a different branch of the 'tree of life', although not too far removed.

As you can see this one was growing on sand dunes. The stalks broke when I picked them; they were about twice as long as pictured. They had white basal mycelium.

Michael Kuo’s laccaria key and Greg Mueller’s site has Laccaria maritima which, according to Mueller is “Only reported from a few sites in eastern Canada. Known primarily from northern Europe”. Irene, do you know it?

Or am I trying to make something it’s not