This Ascomycete cup fungi is really interesting, but I can't quite figure out what it is. The fruiting bodies are a grayish brown on the abhymenium surface and a light brown surface on the hymenium surface. All of the fruiting bodies have a hole in the top center that is kind of jagged. The cup is deep and goes into a V shape near the stipe. The stipe is rudimentary and ends in a stringose base. They were fruiting in scattered groups and seemed to be various ages. I did not find any with their cups fully opened, so I am not sure they would form a true goblet shape.
The spores were elliptical about a 3:1 ratio and rough looking or textured on the outside of the spore. There was no amyloid reaction in Melzer's.

Width of 22mm
Length of specimen 6cm
Top to base 36mm
hole 10mm

This specimen is smooth and dry, and it was not hairy.

Sequenced on 3/3/21 through FunDiS:
Nucleotide Sequence

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACACAATACTCTGTATTATCCACACACACCTTCTGTGATCCATTTACCTGGTTGCTTCCCGTGGCATCTCGCTTGCTTCAGAGGCCCCTGCCTTCCTGCGTGGGAGGGCAGGTGTGAGCTGCTGCTGGGCCCCCCGGGACCACGGGAAGGTCCAATGAAACCCTGGTTTTTTGATGCCTTCAAGTCTGAAATTATTGAATACAAGAAAACTGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCACGCCTGTTCGAGCGTCATTAAGTCAACCCTCAAGCCTCCTTTGGTTTGGTCATGGAACTGAACGGCCGGACCCGCTTGGGATCCGGTCGGTCTACTCCGAAATGCATTGTTGCGGAATGCCCCAGTCGGCACAGGCGTAGTGAATTTTCTATCATCGTCTGTTTGTCCGCGAGGCGTTCCCGCCCACCGAACCCAATAAACCTTTCTCCTAGTTGACCTCGAATCAGGTGGGGATACCCGCTGAACTTAA