Summary
1
Hygrocybe conica, commonly known as the witch's hat, conical wax cap or conical slimy cap, is a colourful member of the genus Hygrocybe (the waxcaps), found across northern Europe and North America. Originally described as Hygrophorus conicus, it may actually be a complex of closely related and similar species.
Barcode data: hygrocybe conica
2
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There are 6 barcode sequences available from BOLD and GenBank.
Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.
See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CGCTTTTTCAGTATTAATTAGATTAGAATTATCTTCTCCAGGTGTACAATTTTTACAAGGAGATCACCAATTATTTAATGTTATTATAACAGCTCACGCTTTTATAATGATCTTTTTTATGGTAATGCCTGGACTTGTTGGAGGTTTTGGTAATTATTTATTACCTGTTCAAATAGGAGCCCCTGATATGGCATTTCCTAGATTGAATAATATTTCTTTTTGGTTATTACCTCCTTCTTTAATTTTATTGCTTGTTAGTTCTTTAGTAGAAAATGGAGCAGGTACAGGATGGACAGTTTATCCGCCTTTATCTAGCATTCAATCACATTCAGGAGGTAGCGTTGATTTAGCTATTTTTAGTTTACACCTTGCAGGAGTTTCTTCTTTATTAGGTGCTATTAATTTTATAACTACTGTACTTAATATGAGAACTAATGGGATGAGTTTACACAAATTACCTTTATTTGTATGGGCAATTTTTGTAACTGCTATACTATTATTACTTGCATTACCTGTATTAGCTGGTGCAATCACTATGCTTCTTACAGATAGAAACTTTAATACTAGTTTCTATGATCCAGCAGGAGGTGGTGATCCTATTCTATATCAACATCTATCT
-- end --
Download FASTA File
Sources and Credits
- (c) Wikipedia, some rights reserved (CC BY-SA),
http://en.wikipedia.org/wiki/Hygrocybe_conica
- (c) Barcode of Life Data Systems, some rights reserved (CC BY),
http://eol.org/data_objects/30754387
More Info