Classification
Within iNaturalist.org

All Names

  • Scientific Names
    • Cortinarius caperatus
  • English
    • Gypsy Mushroom

Guide Colors

No colors selected..

Extras

Taxonomic changes »

Taxon schemes »

Make taxonomic Flickr tags for this taxon »

Invite photos from other sites »

Wikipedia taxobox »

Search descendant taxa »

Embed a widget for this taxon on your website »

Recent observations

Photos / Sounds

What

Gypsy Mushroom Cortinarius caperatus

Observer

alan_rockefeller

Date

March 20, 2016

Description

Ryan Gaber collection.

Growing near Picea sitchensis, hemlock and alder.

ITS sequence: TGATGAGTTGCTGCTGGTTCTCTAGGGAGCATGTGCACACTTGTCGTCTTTATATTTCCACCTTGT

GCACCTTTTGTAGACCTGGATATCTCTCTGAATGCACACAAGCATTTGGGTTTGAGGGGTTGACTTTTTGGTCTCCCTTT

ATATTTCCAGGCCTATGTTTCTTTCATATACCCCACTTGTGTTATAGAATGTAATAAATGGGCCTTTGTGCCTGTAAAGC

TATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGC

AGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCAT

TAATATATCAACCTCCTCAACTTGTGTTGAGTGTTGGATGTGGGGGTTCTTTCTTTGCTGGCTTCACGGTCAGCTCCCCT

GAAATGCATTAGCGGAACAACCTGTTCACTGTTCATTGGCGTGATAACTATCTACGCTGCTTGTTGACAGTGAAGCAAGT

TCAGCTTCTAACAGTCCATTAAATTGGACAAATTTTTATTAATGTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTA

AGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGACAAGCTCAAATTT

AAAATCTGTCAGCCTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTGTAATCCGCGCTGGAC

Photos / Sounds

Square

What

Gypsy Mushroom Cortinarius caperatus

Observer

alan_rockefeller

Date

July 27, 2014

Description

Collected for the Cuajimoloyas fungus fair.

Photos / Sounds

Square

What

Gypsy Mushroom Cortinarius caperatus

Observer

alan_rockefeller

Date

July 21, 2013

Description

On display at the Cuajimoloyas fungus fair.

Photos / Sounds

What

Gypsy Mushroom Cortinarius caperatus

Observer

alan_rockefeller

Date

November 19, 2012

Description

Under Abies or Picea.

Photos / Sounds

What

Gypsy Mushroom Cortinarius caperatus

Observer

alan_rockefeller

Date

July 22, 2012

Description

A Cortinarius with an annulus. Common in this area. Under pine, probably Pinus hartwegii.

Photos / Sounds

What

Gypsy Mushroom Cortinarius caperatus

Observer

carita

Date

October 10, 2016 03:39 PM PDT

Photos / Sounds

What

Gypsy Mushroom Cortinarius caperatus

Observer

daviswj

Date

September 16, 2016 08:54 AM EDT

Photos / Sounds

Square

What

Gypsy Mushroom Cortinarius caperatus

Observer

fungee

Date

September 12, 2016 11:50 AM EDT

Description

Oak and mixed woods.

Photos / Sounds

Square

What

Gypsy Mushroom Cortinarius caperatus

Observer

carita

Date

September 7, 2008 09:41 AM PDT

Photos / Sounds

What

Gypsy Mushroom Cortinarius caperatus

Observer

doucette_clan

Date

August 29, 2016 08:18 AM EDT

Description

Under a playground structure, under a tree lots.

Photos / Sounds

Square

What

Gypsy Mushroom Cortinarius caperatus

Observer

almantas

Date

August 26, 2016 10:17 AM AST

Photos / Sounds

No photos or sounds

What

Gypsy Mushroom Cortinarius caperatus

Observer

noah_siegel

Date

November 23, 2014
View all observations

Description from Wikipedia

Cortinarius caperatus, commonly known as the gypsy mushroom, is a highly esteemed edible mushroom of the genus Cortinarius found in northern regions of Europe and North America. It was known as Rozites caperata for many years, before genetic studies revealed it lay within the large genus Cortinarius. The ochre-coloured fruiting bodies appear in autumn in coniferous and beech woods, as well as heathlands in late summer and autumn. The gills are free and clay-coloured and the...

No range data available.
Member of the iNaturalist Network   |   Powered by iNaturalist open source software