Classification
Within iNaturalist.org

All Names

  • Scientific Names
    • Dothideomycetes

Extras

Taxonomic changes »

Taxon schemes »

Make taxonomic Flickr tags for this taxon »

Invite photos from other sites »

Wikipedia taxobox »

Search descendant taxa »

Embed a widget for this taxon on your website »

Square 89060 98 68 89060 98 68 17521 98 68 8570680583 05163fefe3 s Square 7149336749 d25dc18a15 s 7149336749 d25dc18a15 s 05845 98 68 05845 98 68 05845 98 68 75px botryosphaeria rhodina 75px botryosphaeria rhodina 75px botryosphaeria rhodina 75px botryosphaeria rhodina Square Square Square Square Square Square Square Square Square
Creative Commons Flickr Photos Tagged "Dothideomycetes."

Recent observations

Photos / Sounds

Square

Observer

jaykeller

Date

May 1, 2016 07:55 AM PDT

Photos / Sounds

No photos or sounds

Observer

lattanz

Date

June 18, 2016

Photos / Sounds

Square

Observer

james5

Date

July 13, 2016 08:30 PM ADT

Photos / Sounds

Square

What

Black Knot Apiosporina morbosa

Observer

jmcalpin

Date

July 2, 2016 06:10 PM EDT

Photos / Sounds

Square

What

Black Knot Apiosporina morbosa

Observer

jwalewski

Date

July 9, 2016 03:33 PM CDT

Photos / Sounds

Square

Observer

leptonia

Date

July 8, 2016 08:53 AM PDT

Description

On pines albicaulis - perhaps H. juniperi - or Neopeckia?

Photos / Sounds

What

Black Knot Apiosporina morbosa

Observer

noah_siegel

Date

May 30, 2012

Photos / Sounds

Square

What

Black Knot Apiosporina morbosa

Observer

noah_siegel

Date

February 6, 2010

Description

growing on Black Cherry Prunus serotina

Photos / Sounds

Observer

noah_siegel

Date

August 30, 2009

Description

also see http://mushroomobserver.org/24926

growing on a tomato.

Photos / Sounds

Observer

leptonia

Date

December 8, 2014

Description

Growing in wet mixed duff. Some appeared to be emerging from Redwood needles, but difficult to determine. The first image shows some that were emerging from a rotten Rhododendron (?) twig. Other options are California-Bay Laurel (Umbellularia californica) and Coast Live Oak (Quercus agrifolia) leaves.

>CSALVA231_UCSC-F-00120_Anthina sp_8 Dec 2014_UC Santa Cruz, California, USA_

GTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATTA

TTCATCGGAAGAGTCCAGGTGGGCGGTGGAGGCATGGGAAACCATGCTTACCA

CACGCCCCTTCTTCATGAACATCCCATCTGTGTATCAAACCTTTGTTGCTTCCCG

CATGGCGTGGCCTGCAAGGGCTATGCCGCGGGGAGGAAACCATAAACTCTGGT

TGTTGTATTCTTAGTCTGAGTGGTAAACACATTAAACAAGTTAAAACTTTCAACA

ACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAG

TGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTC

TGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATCAAACACATCCTCAAGCT

TTTTGCTTGGTATTGGAGGACGATGTCAGCATCTCCTCTCAAATCCCTCAGCGG

AAACTACTGCGGTGTCAGGTGTCATAAGATTACCTTTCGCTTGATAACTGCTGGT

AGGTTCTTGCTGTGAAGAGCCCCCCAGCTATTTTTTTTACGTTGACCTCG

Part of specimen will be sent to Joey Tanney

Photos / Sounds

No photos or sounds

Observer

leptonia

Date

February 2, 2015

Photos / Sounds

Square

Observer

leptonia

Date

January 4, 2015

Description

on old, dried frbs of Xeromphalina campanella

View all observations

Description from Wikipedia

Dothideomycetes is the largest and most diverse class of ascomycete fungi. It comprises 11 orders 90 families, 1300 genera and over 19,000 known species. Traditionally, most of its members were included in the loculoascomycetes, which is not part of the currently accepted classification. This indicates that several traditional morphological features in the class are not unique and DNA sequence comparisons are important to define the class.

No range data available.
Member of the iNaturalist Network   |   Powered by iNaturalist open source software