Vermillion Waxcap (Fungi of Northern Maine)

Vermillion Waxcap

Hygrocybe miniata

Summary ⁷

Hygrocybe miniata, commonly known as the vermilion waxcap, is a small, bright red, or red-orange mushroom of the waxcap genus Hygrocybe. It is a cosmopolitan species, that is found worldwide. In Europe, it is found in fields, on sandy heaths, or grassy commons in the autumn (fall). It is found in rainforest and eucalypt forest as well as heathland in Australia.

Barcode data: hygrocybe miniata ⁸

The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCAGTTTTAATAAGATTAGAATTAGCTTCTCCAGGAGTACAATTTTTACAAGGAGATCATCAATTATTTAATGTAATAATATCTGCTCATGCTTTTATAATGATTTTCTTTATGGTTATGCCTGGACTTGTAGGTGGTTTTGGTAATTATTTATTACCAGTACAAATAGGAGCTCCAGATATGGCATTTCCAAGATTAAATAATATTTCTTTTTGGTTATTACCACCTTCATTAATATTATTATTATTAAGTTCTTTAGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCTCCATTAGCTAGTATTCAAGCACATTCAGGTGGAAGTGTTGATTTAGCTATTTTTAGTTTACATCTTGCTGGAGTTTCCTCATTATTAGGGGCAATAAATTTTATAACTACTGTATTAAATATGAGAACAAATGGTATGGGATTACATAAATTACCTTTATTTGTATGGGCTATCTTTGTTACTGCCATATTATTATTACTTGCTTTACCTGTTTTAGCTGGTGCAATTACAATGTTATTAACAGATAGAAATTTTAATACTAGTTTTTATGATCCAGCTGGAGGTGGTGATCCTATTTTGTATCAACATTTATT
-- end --

Download FASTA File