Tucán pico canoa

Ramphastos sulfuratus

Resumen 6

El tucán pico iris (Ramphastos sulfuratus) es una especie de ave de la familia Ramphastidae. Esta especie puebla las selvas entre el sur mexicano y Colombia. Es el ave nacional de Belice.

Barcode data: ramphastos sulfuratus 7

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACCTCATCTTCGGCGCATGAGCAGGCATAATCGGCACAGCCCTGAGTCTCCTCATCCGAGCAGAGCTTGGCCAGCCAGGAACCCTCCTGGGCGACGACCAAATCTACAACGTAATTGTTACCGCCCACGCATTCGTAATAATCTTCTTCATAGTTATGCCTATTATAATCGGAGGCTTTGGCAACTGACTCGTTCCCCTAATAATCGGAGCCCCCGACATAGCCTTCCCACGCATGAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTCCTCCTTGCCTCATCCACAGTCGAAGCTGGAGCCGGAACCGGATGAACTGTTTACCCCCCTCTAGCCGGTAACCTAGCCCATGCCGGAGCCTCAGTCGATCTGGCCATCTTCTCCTTACATTTAGCAGGAGTCTCATCCATCCTCGGTGCAATCAATTTCATCACCACCGCCATCAACATAAAACCACCAGCCATCTCACAATATCAAACACCACTATTCGTCTGATCCGTACTCATCACTGCCGTACTACTTCTTCTTTCCCTCCCCGTCCTCGCCGCAGGCATCACTATACTCCTCACTGATCGTAACCTAAACACTACATTCTTCGACCCAGCTGGAGGAGGTGACCCCGTCCTATATCAACATCTCTTCTGATTCTTT
-- end --

Download FASTA File

Sources and Credits

  1. (c) Joachim S. Müller, some rights reserved (CC BY-NC-SA), http://www.flickr.com/photos/74743437@N00/4410649350
  2. (c) dominic sherony, some rights reserved (CC BY-SA), https://upload.wikimedia.org/wikipedia/commons/thumb/e/e5/Keel-billed_Toucan_2495424699.jpg/460px-Keel-billed_Toucan_2495424699.jpg
  3. (c) Franz Xaver, some rights reserved (CC BY-SA), https://upload.wikimedia.org/wikipedia/commons/6/64/Ramphastos_sulfuratus_1.jpg
  4. (c) Franz Xaver, some rights reserved (CC BY-SA), https://upload.wikimedia.org/wikipedia/commons/a/a7/Ramphastos_sulfuratus_2.jpg
  5. (c) Dominic Sherony, some rights reserved (CC BY-SA), http://farm4.static.flickr.com/3174/2495424699_96e7a72f54.jpg
  6. (c) Wikipedia, some rights reserved (CC BY-SA), http://es.wikipedia.org/wiki/Ramphastos_sulfuratus
  7. (c) Barcode of Life Data Systems, some rights reserved (CC BY), http://eol.org/data_objects/30603264

More Info