Caracara quebrantahuesos

Caracara cheriway

Resumen 7

El carancho norteño (Caracara cheriway) es una especie de ave de presa que pertenece a la familia Falconidae. Es nativo de América del Sur, el Caribe, América Central, y América del Norte hasta el sur de los Estados Unidos. Era anteriormente considerado conespecífico con C. plancus y C. lutosa.

Barcode data: caracara plancus 8

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTTATACCTACTCTTCGGAGCATGAGCCGGTATAGTTGGCACCGCCCTTAGCCTACTCATCCGTGCAGAACTAGGCCAACCCGGAACTCTCCTGGGAGACGACCAAATTTACAACGTAATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGCGGCTTTGGAAACTGATTAGTCCCCCTTATAATCGGTGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTCTGACTCCTACCCCCATCCTTTCTCCTACTACTAGCCTCCTCCACAGTAGAAGCTGGAGTCGGTACCGGATGAACCGTATACCCTCCCCTAGCAGGCAACCTAGCCCACGCCGGCGCCTCAGTAGACTTGGCCATCTTCTCCCTCCACTTAGCAGGAGTATCCTCCATCCTAGGGGCAATCAACTTCATCACAACAGCTATCAACATAAAACCACCAGCCCTCTCACAGTACCAAACCCCCCTCTTTGTCTGATCTGTACTTATCACTGCTGTCCTCCTCCTACTCTCACTACCAGTTCTTGCCGCAGGCATTACCATACTGCTAACCGACCGAAACCTAAACACCACATTCTTCGACCCAGCCGGCGGAGGCGATCCTATCCTATACCAACACCTATTCTGATTCTTCGGCCACCCTGAAGTCTACATCCTAATCCTA
-- end --

Download FASTA File

Sources and Credits

  1. (c) Jamie Drake, some rights reserved (CC BY-NC-SA), http://www.flickr.com/photos/56947492@N00/367630743
  2. (c) Edward Weston, some rights reserved (CC BY-SA), https://upload.wikimedia.org/wikipedia/commons/5/5c/Caracara_cheriway_-Esparza%2C_Puntarenas%2C_Costa_Rica-8.jpg
  3. (c) Caracara_plancus_-Fazenda_Campo_de_Ouro,_Piraju,_Brasil-8.jpg: Dario Sanches from São Paulo, Brazil. derivative work: Snowmanradio, some rights reserved (CC BY-SA), https://upload.wikimedia.org/wikipedia/commons/0/00/Caracara_plancus_-Fazenda_Campo_de_Ouro%2C_Piraju%2C_Brasil-8-3c.jpg
  4. (c) Kevin Jones from Vancouver, Canada, some rights reserved (CC BY), https://upload.wikimedia.org/wikipedia/commons/0/03/Caracara_Quebrada_del_Condorito.jpg
  5. (c) Dario Sanches from SÃO PAULO, BRASIL, some rights reserved (CC BY-SA), https://upload.wikimedia.org/wikipedia/commons/0/0e/Flickr_-_Dario_Sanches_-_CARCAR%C3%81_%28Caracar%C3%A1_plancus%29_%283%29.jpg
  6. (c) Dario Niz, some rights reserved (CC BY), https://upload.wikimedia.org/wikipedia/commons/9/9b/Carancho_Caracara_plancus_Dario_Niz.jpg
  7. (c) Wikipedia, some rights reserved (CC BY-SA), http://es.wikipedia.org/wiki/Caracara_cheriway
  8. (c) Barcode of Life Data Systems, some rights reserved (CC BY), http://eol.org/data_objects/30599265

More Info