Photos / Sounds

What

Spruce Cone Ascomycete Phragmotrichum chailletii

Observer

phroxian

Date

August 23, 2021 06:11 PM EDT

Description

On spruce cones

Photos / Sounds

What

Butterflies and Moths Order Lepidoptera

Observer

water_ouzel

Date

September 11, 2021 03:07 PM AKDT

Photos / Sounds

What

Spotted Orbweavers Genus Neoscona

Observer

jmrobertia

Date

August 12, 2021 04:54 PM AKDT

Photos / Sounds

Observer

madhipp11

Date

July 29, 2020 01:07 PM AKDT

Photos / Sounds

Observer

mbowser

Date

July 20, 2021 06:33 PM AKDT

Description

On gills of rainbow trout

Photos / Sounds

What

Prickly Saxifrage Saxifraga tricuspidata

Observer

frankiecoburn

Date

September 4, 2021 02:33 PM HST

Photos / Sounds

What

Aphids Family Aphididae

Observer

sam907

Date

July 2021

Place

Alaska, US (Google, OSM)

Description

Fairly large gall-looking mass on a Populus tremuloides. Looks like it might be composed of its leaves, or maybe it is a gall of the petiole This could be potentially caused by a number of different insects; mites, aphids, midges, etc.

Photos / Sounds

What

Typical Sawflies Superfamily Tenthredinoidea

Observer

muir

Date

July 4, 2021 12:55 PM AKDT

Photos / Sounds

What

Sawflies, Horntails, and Wood Wasps Suborder Symphyta

Observer

hubertszcz

Date

August 16, 2021 12:01 PM CST

Photos / Sounds

What

Eyed Hawkmoths Genus Smerinthus

Date

August 16, 2021 04:45 PM AKDT

Photos / Sounds

Observer

danabrennan

Date

September 19, 2020 02:28 PM AKDT

Description

Pretty stumped on this one. Will get all the other obs I have throughout interior Alaska up soon.

Photos / Sounds

Observer

gwark

Date

June 21, 2021 09:36 PM AKDT

Description

found on violet rust which I had collected on 19 June (location is where rust was collected)

Photos / Sounds

What

Wood, Mound, and Field Ants Genus Formica

Observer

siwanicki

Date

August 30, 2021 04:19 PM AKDT

Photos / Sounds

Observer

gagraziano

Date

June 2, 2016 09:21 AM AKDT

Photos / Sounds

What

Cream-spotted Ladybird Calvia quatuordecimguttata

Observer

isqee

Date

May 19, 2016 05:35 PM UTC

Photos / Sounds

What

Black-rimmed Prominent Pheosia rimosa

Observer

gbryson

Date

August 12, 2021 09:28 PM UTC

Photos / Sounds

What

Willow Sawflies Genus Nematus

Observer

hubertszcz

Date

August 2, 2021 05:15 PM CST

Photos / Sounds

Observer

muir

Date

July 12, 2021 04:14 PM AKDT

Photos / Sounds

What

Sawflies, Horntails, and Wood Wasps Suborder Symphyta

Observer

muir

Date

July 30, 2021 09:14 AM AKDT

Photos / Sounds

What

Willow Sawflies Genus Nematus

Observer

danabrennan

Date

July 27, 2021 07:43 AM PDT

Description

On balsam poplar

Photos / Sounds

Observer

gwark

Date

July 28, 2021 12:37 PM AKDT

Photos / Sounds

What

Cream-spotted Ladybird Calvia quatuordecimguttata

Observer

muir

Date

June 29, 2021 05:55 PM AKDT

Photos / Sounds

What

Sawflies, Horntails, and Wood Wasps Suborder Symphyta

Observer

machi

Date

July 20, 2021 09:15 PM EDT

Description

Found in a Red Elderberry stand, but there was also Salmonberry and Alder here.

Photos / Sounds

What

Yellow-horned Horntail Urocerus flavicornis

Observer

ambersak

Date

July 26, 2021 01:58 PM AKDT

Place

Palmer (Google, OSM)

Description

On Lazy Mountain, hanging out in the alders

Photos / Sounds

Observer

sam907

Date

July 2021

Description

Large sized stem gall found on a wild raspberry plant. Gall was red in color and looked like almost like a strawberry on the outside. It was covered in thorns just like the stem and was hard to the touch. There were 3 more tiny galls on the stem just below the main mass (visible in the first and fourth pictures). This gall could be caused by a number of things (aphid, mite, midge, fungi, etc.) but I believe that an insect causing this gall is more likely then a fungus.

Photos / Sounds

Observer

machi

Date

August 11, 2020 01:00 AM EDT

Description

On Nootka Rose

Photos / Sounds

What

Aspen Leaf Gall Midge Harmandiola tremulae

Observer

hubertszcz

Date

July 1, 2021 10:17 AM CST

Photos / Sounds

What

Narrow-waisted Wasps, Ants, and Bees Suborder Apocrita

Observer

russeld

Date

July 10, 2021 02:04 PM AKDT

Photos / Sounds

What

Sawflies, Horntails, and Wood Wasps Suborder Symphyta

Observer

hubertszcz

Date

July 20, 2021 10:03 AM CST

Photos / Sounds

Observer

jonathangoff

Date

July 19, 2021 04:58 PM PDT

Photos / Sounds

What

Poplar Twiggall Fly Euhexomyza schineri

Observer

hubertszcz

Date

July 13, 2021 12:28 PM CST

Photos / Sounds

What

Monarch Danaus plexippus

Observer

aspleha98

Date

August 20, 2020 04:08 AM UTC

Photos / Sounds

What

Langton's Forester Alypia langtoni

Observer

sam907

Date

June 2021

Place

Alaska, US (Google, OSM)

Photos / Sounds

What

Large Red-belted Clearwing Moth Synanthedon culiciformis

Observer

steelbirder

Date

June 13, 2021 04:18 PM CDT

Photos / Sounds

What

Thread-waisted Sand Wasps Genus Ammophila

Observer

robertweeden

Date

July 5, 2021 12:14 PM AKDT

Description

15 mm
possibly Ammophila placida

This female parasitic wasp entered the hole pictured head first. It was underground very briefly (only 15-20 seconds) before emerging again, also head first. It flew off but returned shortly afterwards carrying a clump of sand in its jaws which it used to plug the hole.

https://bugguide.net/node/view/1996663

Photos / Sounds

What

Ulkei's Boreal Lady Beetle Ceratomegilla ulkei

Observer

csyampae

Date

June 14, 2021 06:16 PM UTC

Description

Possibly the first picture of the species in the wild

Photos / Sounds

What

Gleaming Lady Beetle Coccinella fulgida

Observer

csyampae

Date

June 5, 2021 08:40 PM UTC

Photos / Sounds

What

Tree Swallow Tachycineta bicolor

Observer

karl93

Date

May 31, 2021 10:33 AM AKDT

Photos / Sounds

What

Northern Red-banded Yellowjacket Vespula intermedia

Observer

abiabi

Date

June 1, 2021 04:33 PM AKDT

Description

6-1-21 Vespula intermedia - Northern Red-banded Yellowjacket. (my ID based on BugGuide & iNat observations)

Found inside the house this morning when it landed on the rim of my coffee cup! Fortunately it did not get drenched with hot coffee when my cup landed. This is the first time I have ever seen this type of Yellowjacket here.

Captured in jar and put in fridge to chill for portrait images. The Squares on the paper are 6mm to a side. The creature warmed up rapidly and kept turning away from camera lens so it was impossible to get a lateral view in focus. Will keep trying and then release this beautiful creature.

Photos / Sounds

What

Arctic Aerial Yellowjacket Dolichovespula albida

Observer

muir

Date

May 30, 2021 01:47 PM AKDT

Photos / Sounds

What

Ashton's Cuckoo Bumble Bee Bombus ashtoni

Observer

awenninger

Date

June 2020

Photos / Sounds

What

Marsh Ground Beetles Genus Elaphrus

Observer

robertweeden

Date

May 24, 2021 03:45 PM AKDT

Description

Measured at 6.5 mm

Found on muddy 4-wheeler track near Tanana River. Also submitted to BugGuide: https://bugguide.net/node/view/1972364

Photos / Sounds

What

Cream-spotted Ladybird Calvia quatuordecimguttata

Observer

muir

Date

May 18, 2021 11:19 AM AKDT

Photos / Sounds

What

Sickle-marked Lady Beetle Hippodamia falcigera

Observer

dssikes

Date

May 10, 2021 03:55 PM AKDT

Photos / Sounds

What

Clark's Mining Bee Andrena clarkella

Observer

jrfulkerson

Date

May 2, 2021 06:06 PM AKDT

Photos / Sounds

What

Black Knot Apiosporina morbosa

Observer

bwelko

Date

May 2020

Photos / Sounds

What

Three-banded Lady Beetle Coccinella trifasciata

Observer

dssikes

Date

April 21, 2021 12:25 PM AKDT

Photos / Sounds

What

Beehive Honey Moth Vitula serratilineella

Observer

robertweeden

Date

September 7, 2019 11:59 PM AKDT

Description

FWL = 11 mm
aspen forest (We do have honey bees coming from the neighbors hives)
attracted to 100 W black light
Thanks to David W Droppers for id.
This is the only Vitula species recorded in Alaska by Ferris

Photos / Sounds

What

Wood Tiger Arctia plantaginis

Observer

machi

Date

July 22, 2020 05:52 PM EDT

Photos / Sounds

What

Black-tailed Bumble Bee Bombus melanopygus

Observer

machi

Date

June 19, 2019 07:42 PM EDT

Description

I think an animal dug up the nest and spread it around on the ground. Several of the cells still had bees in them, so I moved them to a protected mossy spot in the hopes some were still viable. I believe they were close to emerging already, as you can see in the photos that the one I did observe emerging seemed to be well developed. I did see one fully emerged one crawling among them that looked pretty dry. It was still a bit slow though.

Photos / Sounds

What

Cuckoo Leaf-cutter Bees Genus Coelioxys

Observer

robertweeden

Date

July 12, 2020 02:43 PM AKDT

Description

Here is another interesting find for Alaska. Several species have records in Alaska on ARCTOS but I do not know what to look for to try and sort them out.

also submitted to BugGuide: https://bugguide.net/node/view/1941104

Photos / Sounds

Observer

robertweeden

Date

August 3, 2020 12:13 AM AKDT

Description

Attracted to 100 W black light. According to the good folks at BugGuide, the host for this species is the Elm Sawfly.

https://bugguide.net/node/view/1869104#3084313

Photos / Sounds

Observer

jasonrgrant

Date

August 3, 2020 08:40 PM AKDT

Description

On Populus tremuloides
@ceiseman

Photos / Sounds

What

Alaska Yellowjacket Vespula alascensis

Observer

annelised

Date

September 20, 2020 07:11 PM AKDT

Description

A dozen of individuals found in brown bear feces. Brown bear observation: https://www.inaturalist.org/observations/63616543

Photos / Sounds

Observer

muir

Date

September 4, 2020 01:22 PM AKDT

Photos / Sounds

What

Phoebus Apollo Parnassius phoebus

Observer

samdubbz

Date

July 12, 2017 04:47 PM EDT

Photos / Sounds

Observer

pauls_tucson

Date

July 15, 2007 10:42 AM MST

Photos / Sounds

Observer

robertweeden

Date

May 9, 2020 06:05 PM AKDT

Description

FWl = 8 mm
when resting, this moth held its head low and its abdomen high

id courtesy of David W Droppers: https://www.butterfliesandmoths.org/sighting_details/1248003

Photos / Sounds

What

Snailfishes Family Liparidae

Observer

hm2flip

Date

November 14, 2020 08:32 PM AKST

Place

AK, US (Google, OSM)

Description

Caught off of Hooper Bay AK

Photos / Sounds

What

Parasitic Aerial Yellowjacket Dolichovespula arctica

Observer

muir

Date

July 17, 2020 12:58 PM AKDT

Photos / Sounds

Observer

muir

Date

July 17, 2020 02:42 PM AKDT

Photos / Sounds

What

Sharp-lined Yellow Sicya macularia

Observer

cynestor

Date

August 9, 2007 11:45 AM PDT

Photos / Sounds

What

Northern Groundcone Boschniakia rossica

Observer

khalildashay

Date

May 27, 2020 08:56 PM AKDT

Photos / Sounds

Observer

muir

Date

September 4, 2020 01:15 PM AKDT

Photos / Sounds

What

California Lady Beetle Coccinella californica

Observer

sialialascensis

Date

September 1, 2020 03:11 PM AKDT

Description

Going with iNat’s tip suggestion, but input welcome.

Photos / Sounds

Observer

jasonrgrant

Date

July 26, 2020 10:33 PM AKDT

Description

Observations at Fielding Lake

Photos / Sounds

What

Drab Birch Pigmy Stigmella lapponica

Observer

awenninger

Date

August 19, 2020 09:30 AM AKDT

Photos / Sounds

What

Purplish Birch-miner Moth Eriocrania semipurpurella

Observer

robertweeden

Date

May 2, 2020 07:24 PM AKDT

Description

6 mm FWL
40 F
aspen forest
id courtesy of Bob Biagi @ BugGuide

Photos / Sounds

What

California Horntail Urocerus californicus

Observer

stephcoates

Date

August 27, 2020 11:42 AM AKDT

Description

At construction site

Photos / Sounds

Observer

danabrennan

Date

August 6, 2020 11:19 AM PDT

Description

ID from lifescanner BOLD-DK1

Photos / Sounds

Observer

danabrennan

Date

May 28, 2020 12:47 PM AKDT

Description

Host is Alaskan paper birch. Lifescanner ID Eriocraniidae from BOLD-F37. DNA barcode: COI-5P
AACCTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCAGAATTAGGTAACCCTGGTTCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGCAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATGCCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATCACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTCG-

Photos / Sounds

What

Leaf Blotch Miner Moths Family Gracillariidae

Observer

danabrennan

Date

August 26, 2020 11:42 AM AKDT

Description

Possible pupa from mine?

Photos / Sounds

What

Ichneumonid Wasps Family Ichneumonidae

Observer

muir

Date

August 29, 2020 09:01 AM AKDT

Photos / Sounds

Observer

danabrennan

Date

August 6, 2020 11:42 AM AKDT

Photos / Sounds

Observer

danabrennan

Date

August 17, 2020 01:53 PM AKDT

Description

On balsam poplar, several larvae per blotch mine

Photos / Sounds

What

Dusky Birch Sawfly Craesus latitarsus

Observer

delaneyvinson

Date

July 24, 2020 02:45 PM AKDT

Photos / Sounds

What

Norton's Giant Ichneumonid Wasp Megarhyssa nortoni

Observer

jmrobertia

Date

July 15, 2020 03:13 PM AKDT

Description

This wasp is the stuff of children's nightmares, lol. Saw several, apparently laying eggs in some cut (green) spruce log.

Photos / Sounds

What

Parasitic Aerial Yellowjacket Dolichovespula arctica

Observer

muir

Date

July 17, 2020 12:33 PM AKDT

Place

Glen Alps (Google, OSM)

Photos / Sounds

Observer

robertweeden

Date

July 19, 2020 02:14 PM AKDT

Description

25mm

We had lots of Papilio canadensis around earlier in the summer - presumably this wasp has (or will) parasitize a crysalis from one of them.

An iNat first for Alaska.

See: https://bugguide.net/node/view/1858788

Photos / Sounds

What

Wood Tiger Arctia plantaginis

Observer

nefariousdrru

Date

July 11, 2020 02:59 PM AKDT

Photos / Sounds

What

Small Round-leaved Orchid Galearis rotundifolia

Observer

mbowser

Date

July 2, 2020 11:19 AM AKDT

Photos / Sounds

What

Northern Red Belt Fomitopsis mounceae

Observer

kim215

Date

June 27, 2020 07:09 PM AKDT

Photos / Sounds

Observer

danabrennan

Date

June 27, 2020 04:21 PM AKDT

Photos / Sounds

What

Arctic Aerial Yellowjacket Dolichovespula albida

Observer

abiabi

Date

August 27, 2019 07:00 PM AKDT

Description

8-27-19 Dolichovespula albida

Additional three images show top of the head & white patches behind the eyes, face & antenna markings & the tail patterns.

Feeding in Astilbe.

Would appreciate tips on which specific anatomical aspects of wasps to focus on for ease of ID.

Photos / Sounds

What

Western Tent Caterpillar Malacosoma californica

Observer

k_russ21

Date

June 24, 2020 05:16 PM PDT

Photos / Sounds

What

Battered Sallow Sunira verberata

Observer

achpeterson

Date

June 21, 2020 02:07 PM AKDT

Photos / Sounds

What

Gooseberry Sawfly Nematus ribesii

Observer

connietaylor

Date

June 23, 2020 02:39 PM AKDT

Photos / Sounds

Observer

sialialascensis

Date

June 22, 2020 03:04 PM AKDT

Description

ID help welcome

Photos / Sounds

What

Western Tent Caterpillar Malacosoma californica

Observer

madhipp11

Date

June 2, 2020 02:33 PM AKDT

Photos / Sounds

Observer

robertweeden

Date

June 3, 2020 04:28 PM AKDT

Description

Found a number of these all on alder. This is the preferred host for C. mainensis. Id is based on that and on the amount of spotting. See https://www.inaturalist.org/observations/46982760 for comparison.

Photos / Sounds

Observer

muir

Date

June 18, 2020 09:25 PM AKDT

Description

On birch leaves

Photos / Sounds

What

Battered Sallow Sunira verberata

Observer

mbowser

Date

June 3, 2020

Description

Brought to me by a member of the public from the Marsh Lake Trail, where there are reports of thousands of these dark caterpillars, mostly on aspen.

Photos / Sounds

What

Quinine Conk Laricifomes officinalis

Observer

gwark

Date

June 2020

Photos / Sounds

What

Western Tent Caterpillar Malacosoma californica

Observer

kaylabug

Date

May 30, 2020

Description

There were hundreds of these little guys out by the highway out south of town! First time I have ever seen them here in my nearly 10 years of being in Ketchikan

Photos / Sounds

What

Common Alpine Erebia epipsodea

Observer

robertweeden

Date

June 15, 2020 03:18 PM AKDT

Photos / Sounds

What

Ruby Tiger Moth Phragmatobia fuliginosa

Observer

mbowser

Date

June 9, 2020 10:10 PM AKDT

Photos / Sounds

Observer

dssikes

Date

June 15, 2020 09:58 AM AKDT

Photos / Sounds

What

American Five-spotted Lady Beetle Hippodamia quinquesignata

Observer

muir

Date

July 9, 2014 03:21 PM AKDT

Photos / Sounds

What

Oblong Lady Beetles Genus Hippodamia

Observer

muir

Date

June 14, 2020 03:21 PM AKDT

Photos / Sounds

Observer

ahaberski

Date

May 28, 2020 06:14 PM AKDT