Photos / Sounds

Square

What

Red-bellied Woodpecker Melanerpes carolinus

Observer

goldfeather

Date

September 19, 2019 08:31 AM EDT

Photos / Sounds

Square

What

California Ground Squirrel Otospermophilus beecheyi

Observer

goldfeather

Date

August 9, 2010 08:46 AM EDT

Photos / Sounds

Square

What

White-tailed Kite Elanus leucurus

Observer

goldfeather

Date

August 9, 2010 05:45 PM EDT

Photos / Sounds

Square

What

California Sea Lion Zalophus californianus

Observer

goldfeather

Date

January 28, 2011 02:51 PM EST

Photos / Sounds

What

Red Knot Calidris canutus

Observer

goldfeather

Date

January 28, 2011 03:57 PM EST

Photos / Sounds

Square

What

Vesper Sparrow Pooecetes gramineus

Observer

goldfeather

Date

September 10, 2010 08:13 AM EDT

Description

Vesper Sparrow - Pooecetes gramineus

Photos / Sounds

Square

What

Long-tailed Duck Clangula hyemalis

Observer

goldfeather

Date

January 1, 2020 10:22 AM EST

Description

Long-tailed Duck (male, non-breeding) - Clangula hyemalis

Photos / Sounds

Square

What

American Wigeon Mareca americana

Observer

goldfeather

Date

January 1, 2020 12:12 PM EST

Description

American Wigeon [Duck] (female) - Anas americana

Photos / Sounds

Square

What

Song Sparrow Melospiza melodia

Observer

goldfeather

Date

September 29, 2019 07:52 AM EDT

Photos / Sounds

Square

What

Allen's Hummingbird Selasphorus sasin

Observer

goldfeather

Date

November 3, 2019 11:39 AM EST

Photos / Sounds

Square

Observer

acmicrobiology

Date

December 3, 2019 02:12 PM EST

Description

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

Photos / Sounds

Square

Observer

acmicrobiology

Date

December 3, 2019 02:12 PM EST

Description

Yellow, Gram + cocci
Closest Match: Micrococcus luteus
% identity: 81%
DNA sequence:
ACGTTATCCGCCCCCGGCAGTCTCGGTCCCGGCGTTATGAGAAGCTTGGGGGTG GGGGAGTGGGAAGAAAAGGAGATTATCAGAAGTGGGTGGAGAGAGGAGGGAATT GAAGCTTTCCCGTATTGAGACTCCACGTCGGGGGGGTGATGTGAAGATTCAGCGG GAGCTAAGAAATCGCTTTTGGGCTTATTGTTGGTGACGTAATGGCTACCAATTGTA CCGGCCATTAGACCGTGCGAGAAGGCCAACAGATAAGGGGGATGAGGATTTGACC TCGTACTCACCTTCCTCGGAGTTGACGGCAATATTGTCCCATGAGTCCCCACCTGA ACCTGCTGGCCACCTTGAAGGAGGATTGCCCTCGTGTTGGGACTTAATTTCACATC TCAAGACACGAACTGACGGCAACCATGTACCACCTGTGAACCCGCCCCAAAGGGG AAAACCGTATCTCTACGGCGATCGAGAACATGTTTCAGCCTTGTTTAGGTTCTTCCA AGTTGCCTCGAATTAATCCCGCATGCTGCCTCCGCTTGTGCGGGGGCCCCACGCC AATTCTCTTTTGAGTGGTTAACACTGTGCGGCCGTACTCCCCCAAGGCGGGAGAC ACTGTAATTGCCTGTATCTTGCCGGCGCGAAAGACCCAGATAATGAGTCCCCCACC ACCTAGTGGCCCAACGTATTACGGGCATGGGAACTACAAAGGAGGATTCTAATCC CTGATAGTCTCCCGCATGCCTTTTCCGCGTCCTAAAAAGACCATGTTACAGACCTC TGTAGAACATTGCCCTTCCGGCCATCAGTGGTTCCGTCACTGAAATATCAGCAGTC ATTTCCTCCCCGCTCACCCTCAACGAAGTTACAAGTCTGTCCGCACAACAGGACAA CGTCTAGGTCATGCCACGGTCTCCCCACCTGCAAGAATTCCAGTGGGGCTTGTGA AGGCGCCCCGGCACTGTATCCTCGCTAGCGAGAAGCGTGAAGCGAAAATTCAGTT TCCTTATACTGAC

Photos / Sounds

Square

What

Black-bellied Plover Pluvialis squatarola

Observer

goldfeather

Date

November 2, 2019 08:29 PM EDT

Description

Black-bellied Plover (non-breeding) - Pluvialis squatarola

Photos / Sounds

Square

What

Killdeer Charadrius vociferus

Observer

goldfeather

Date

November 3, 2019 02:14 PM EST

Photos / Sounds

Square

What

Western Grebe Aechmophorus occidentalis

Observer

goldfeather

Date

November 3, 2019 11:12 AM EST

Photos / Sounds

Square

What

Pied-billed Grebe Podilymbus podiceps

Observer

goldfeather

Date

November 3, 2019 11:07 AM EST

Photos / Sounds

Square

What

Black-crowned Night-Heron Nycticorax nycticorax

Observer

goldfeather

Date

November 8, 2019 11:06 AM EST

Photos / Sounds

Square

What

Black-crowned Night-Heron Nycticorax nycticorax

Observer

goldfeather

Date

November 7, 2019 08:41 PM EST

Place

Lindo Lake (Google, OSM)

Photos / Sounds

Square

What

Black-crowned Night-Heron Nycticorax nycticorax

Observer

goldfeather

Date

November 7, 2019 07:57 PM EST

Place

Lindo Lake (Google, OSM)

Photos / Sounds

Square

What

Black-crowned Night-Heron Nycticorax nycticorax

Observer

goldfeather

Date

November 3, 2019 11:23 AM EST

Photos / Sounds

Square

What

House Geckos Genus Hemidactylus

Observer

aphaywood

Date

November 18, 2019 11:35 AM IST

Photos / Sounds

Square

What

Great Blue Heron Ardea herodias

Observer

goldfeather

Date

November 2, 2019 07:38 PM EDT

Photos / Sounds

Square

What

Reddish Egret Egretta rufescens

Observer

goldfeather

Date

November 8, 2019 11:58 AM EST

Photos / Sounds

Square

What

Northern Walkingstick Diapheromera femorata

Observer

goldfeather

Date

August 27, 2019 05:01 AM EDT

Photos / Sounds

Square

What

Eastern Kingbird Tyrannus tyrannus

Observer

goldfeather

Date

July 26, 2019 08:33 AM EDT

Description

Eastern Kingbird [Flycatcher] - Tyrannus tyrannus

Photos / Sounds

Square

What

Green Heron Butorides virescens

Observer

goldfeather

Date

July 26, 2019 08:30 AM EDT

Photos / Sounds

Square

What

Green Heron Butorides virescens

Observer

goldfeather

Date

July 26, 2019 09:57 AM EDT

Description

Green Heron - Butorides virescens

Photos / Sounds

Square

What

Red-winged Blackbird Agelaius phoeniceus

Observer

goldfeather

Date

July 26, 2019 08:16 AM EDT

Photos / Sounds

Square

What

Leopard Slug Limax maximus

Observer

goldfeather

Date

July 3, 2019 05:03 AM EDT

Photos / Sounds

Square

What

Tree Swallow Tachycineta bicolor

Observer

goldfeather

Date

April 21, 2019 09:46 AM EDT

Photos / Sounds

Square

What

Eastern Towhee Pipilo erythrophthalmus

Observer

goldfeather

Date

June 27, 2019 04:26 PM EDT

Photos / Sounds

Square

What

Eastern Bluebird Sialia sialis

Observer

goldfeather

Date

May 24, 2019 09:45 AM EDT

Description

Eastern Bluebird (female) - Sialia sialis

Photos / Sounds

Square

What

Eastern Bluebird Sialia sialis

Observer

goldfeather

Date

May 24, 2019 09:15 AM EDT

Description

Eastern Bluebird (male) - Sialia sialis

Photos / Sounds

What

Common Tern Sterna hirundo

Observer

congonaturalist

Date

June 18, 2019 12:05 PM EDT

Description

Catching a fish

Photos / Sounds

Square

What

Common Snapping Turtle Chelydra serpentina

Observer

goldfeather

Date

May 24, 2019 08:27 AM EDT

Photos / Sounds

Square

What

African Leopard Panthera pardus ssp. pardus

Observer

evan81

Date

April 29, 2019 08:42 PM SAST

Photos / Sounds

What

Swallow-tailed Kite Elanoides forficatus

Observer

alyssacritters

Date

April 29, 2019 06:34 PM EDT

Description

Heard the kite smack into a tree branch and didn't realize what it was doing until it dropped this guy from above!

Photos / Sounds

Square

What

Great Blue Heron Ardea herodias

Observer

goldfeather

Date

April 21, 2019 09:01 AM EDT

Photos / Sounds

Square

What

Ovenbird Seiurus aurocapilla

Observer

goldfeather

Date

April 21, 2019 10:27 AM EDT

Photos / Sounds

Square

What

Brown-headed Cowbird Molothrus ater

Observer

goldfeather

Date

April 21, 2019 08:13 AM EDT

Photos / Sounds

Square

What

Tree Swallow Tachycineta bicolor

Observer

goldfeather

Date

March 31, 2019 06:26 PM EDT

Photos / Sounds

Square

What

Common Loon Gavia immer

Observer

goldfeather

Date

March 31, 2019 07:01 PM EDT

Photos / Sounds

Square

What

Canada Goose Branta canadensis

Observer

goldfeather

Date

March 31, 2019 06:46 PM EDT

Photos / Sounds

Square

What

Common Slider Trachemys scripta

Observer

goldfeather

Date

April 1, 2019 05:23 PM EDT

Photos / Sounds

Square

What

Virginia Bluebells Mertensia virginica

Observer

goldfeather

Date

April 3, 2019 05:36 PM EDT

Photos / Sounds

What

Anhinga Anhinga anhinga

Observer

carrieseltzer

Date

March 29, 2019 05:21 PM EDT

Photos / Sounds

Square

What

Wood Duck Aix sponsa

Observer

goldfeather

Date

March 1, 2019 08:59 PM EST

Photos / Sounds

Square

What

Snowy Egret Egretta thula

Observer

goldfeather

Date

February 25, 2019 09:29 PM EST

Tags

Photos / Sounds

Square

What

Black-crowned Night-Heron Nycticorax nycticorax

Observer

goldfeather

Date

February 25, 2019 09:12 PM EST

Description

Black-crowned Night-Heron - Nycticorax nycticorax

Photos / Sounds

Square

What

Purple Gallinule Porphyrio martinica

Observer

tomdriscoll

Date

February 14, 2019 10:40 AM EST

Photos / Sounds

What

Henderson's Shooting Star Primula hendersonii

Observer

rhjackso

Date

February 28, 2019 03:24 PM PST

Photos / Sounds

Square

What

Short-billed Dowitcher Limnodromus griseus

Date

May 10, 2015 02:25 PM EDT

Photos / Sounds

Square

What

Black-backed Oriole Icterus abeillei

Observer

manuelbecerril

Date

January 4, 2019

Place

Tlalpan (Google, OSM)

Description

Macho.

Photos / Sounds

Square

What

Yellow-rumped Warbler Setophaga coronata

Observer

uzun

Date

January 4, 2019 09:25 AM PST

Photos / Sounds

Square

What

Yellow-rumped Warbler Setophaga coronata

Observer

mattk561

Date

December 13, 2018 09:06 AM PST

Description

Bobelaine Sanctuary

Photos / Sounds

Square

What

Eastern Bluebird Sialia sialis

Observer

goldfeather

Date

December 1, 2018 09:31 AM EST

Photos / Sounds

Square

What

Red-bellied Woodpecker Melanerpes carolinus

Observer

jariemames

Date

November 27, 2018 11:01 AM EST

Photos / Sounds

Square

What

Palm Warbler Setophaga palmarum

Observer

jariemames

Date

November 27, 2018 11:03 AM EST

Photos / Sounds

Square

What

Black-crowned Night-Heron Nycticorax nycticorax

Observer

avocat

Date

November 3, 2018 04:48 PM PDT

Photos / Sounds

Square

What

Perplexing Bumble Bee Bombus perplexus

Observer

bob15noble

Date

July 30, 2018 01:16 PM EDT

Photos / Sounds

What

California Swollenstinger Scorpion Anuroctonus pococki

Observer

ivanvershynin03

Date

November 3, 2018 02:31 PM PDT

Photos / Sounds

Square

What

Eastern Bluebird Sialia sialis

Observer

goldfeather

Date

September 3, 2018 09:33 AM EDT

Description

Eastern Bluebird [Thrush] - Sialia sialis

Photos / Sounds

Square

What

Least Sandpiper Calidris minutilla

Observer

wayne_fidler

Date

August 29, 2018 12:26 PM EDT

Photos / Sounds

Square

What

Blue-gray Tanager Thraupis episcopus

Observer

kenchamberlain

Date

January 31, 2015 05:36 AM PST

Photos / Sounds

Square

What

Red-legged Honeycreeper Cyanerpes cyaneus

Observer

kenchamberlain

Date

January 31, 2015 05:44 AM PST

Photos / Sounds

Square

What

Flame-colored Tanager Piranga bidentata

Observer

kenchamberlain

Date

January 31, 2015 05:32 AM PST

Photos / Sounds

Square

What

Flame-colored Tanager Piranga bidentata

Observer

kenchamberlain

Date

January 31, 2015 11:21 AM PST

Photos / Sounds

What

Northern Mockingbird Mimus polyglottos

Observer

kalamurphyking

Date

September 29, 2015 01:51 PM CDT

Description

Photo 1: Mockingbirds don't eat my birdseed but they love my bird bath.
Photo 2: I was being very still but this look happened when one of my cats jumped up on the window sill to see what was out there. Check out the tiny little water drops on the tail.
Photo 3: In the middle of the bath it just sat and soaked for a minute.
Photo 4: This was taken a moment before it flew up into a tree to preen and dry off.

Photos / Sounds

Square

What

American Bison Bison bison

Observer

brenbarr

Date

July 19, 2018 07:59 AM MDT

Photos / Sounds

Square

What

Cedar Waxwing Bombycilla cedrorum

Observer

dpdawes

Date

July 1, 2018 07:13 PM EDT

Photos / Sounds

What

Common Yellowthroat Geothlypis trichas

Observer

dpdawes

Date

July 1, 2018 07:29 PM EDT

Photos / Sounds

What

Skuas and Jaegers Genus Stercorarius

Observer

liam1294

Date

May 15, 2018 04:49 PM UTC

Photos / Sounds

Square

What

Mexican Jay Aphelocoma wollweberi

Observer

aepigmenio

Date

June 11, 2018 12:40 PM CDT

Photos / Sounds

Square

What

Orbweavers Family Araneidae

Observer

goldfeather

Date

June 29, 2018 06:58 AM EDT

Tags

Photos / Sounds

Square

What

Bee Hummingbird Mellisuga helenae

Observer

markconboy

Date

March 9, 2017 08:46 AM NST

Photos / Sounds

Square

What

Orchard Oriole Icterus spurius

Observer

jpaiero

Date

June 26, 2018 06:13 PM EDT

Photos / Sounds

Square

What

Ridgway's Rail Rallus obsoletus

Observer

goldfeather

Date

May 20, 2018 07:49 PM EDT

Photos / Sounds

Square

What

Osprey Pandion haliaetus

Observer

goldfeather

Date

May 20, 2018 08:46 PM EDT

Photos / Sounds

Square

What

Striped Shore Crab Pachygrapsus crassipes

Observer

goldfeather

Date

April 23, 2018 10:57 AM PDT

Photos / Sounds

What

Dekay's Brownsnake Storeria dekayi

Observer

jfrancis

Date

November 24, 2016 02:51 PM EST

Description

In driveway stationery. Approx 12" long.

Photos / Sounds

Square

What

Bat Falcon Falco rufigularis

Observer

panza_rayada

Date

March 1, 2015 01:07 PM CST

Photos / Sounds

What

Dune Evening Primrose Oenothera deltoides

Observer

carrieseltzer

Date

June 9, 2016 05:34 PM ADT

Photos / Sounds

What

Bald Eagle Haliaeetus leucocephalus

Observer

nanorca13

Date

June 18, 2016 12:41 PM PDT

Description

Young eagle being dive bombed by crow.

Photos / Sounds

What

Bottletail Olpogastra lugubris

Observer

muir

Date

May 26, 2016 02:31 PM ADT

Place

Bomassa (Google, OSM)

Photos / Sounds

What

Centipedes Class Chilopoda

Observer

vzanin

Date

May 7, 2016 10:20 AM EDT

Photos / Sounds

Square

What

Southern Fox Squirrel Sciurus niger ssp. niger

Observer

maryeford

Date

May 1, 2016 02:05 PM EDT