December 06, 2019

Sinanodonta woodiana, Anemica arcaeformis in South Korea

It was believed that Sinanodonta woodiana and Anemica arcaeformis lived in the surrounding rice fields. Anemica arcaeformis thought to be fatter than Sinanodonta woodiana.

https://cafe.naver.com/yangpakor/1999

However, recent comparisons of mtDNA show that they are all one species. And what's more confusing is not exactly what species it is.

In Korea, China, and Japan, the species Sinanodonta woodiana and Anemica arcaeformis appear to be completely different. Yes, when you look at the data on the NCBI.

https://cafe.naver.com/yangpakor/35942

Clearance of these two species is needed and research requires a record of the new species.

Posted on December 06, 2019 10:51 by pintail pintail | 0 comments | Leave a comment

November 19, 2018

Research on the Rana of the Korean Peninsula is very much needed.

There are three species in our country.
Rana coreana is small and easily distinguishable. However, Rana uenoi and Rana huanrenensis were recorded as similar species.

Rana uenoi lives in Jeema Island from Jeju Island to the Korean peninsula.
Rana huanrenensis inhabits the peninsula in Chinese huanren and is smaller than Rana uenoi.

These two species have been recorded in numerous scientific names since the 1930s, sometimes as a species.

Rana uenoi is still recorded as Rana dybowskii. Rana uenoi and Rana dybowskii are likely to live in North Korea. Rana dybowskii is most likely to live in northern North Korea. Rana huenrensis and smaller Rana chensinensis in North Korea

Research on the Rana of the Korean Peninsula is very much needed.

https://cafe.naver.com/yangpakor/33529
https://repository.kulib.kyoto-u.ac.jp/dspace/bitstream/2433/216901/1/zs140080.pdf
http://www.jonjfong.com/Website/Publications_files/Mol.%20Phylogenet.%20Evol.%202017%20Yang.pdf

Posted on November 19, 2018 14:10 by pintail pintail | 0 comments | Leave a comment

November 18, 2018

In 2018, about a quarter of the population is likely to be compared to 2008.

It is impossible to compare amphibian populations.
However, we tried to compare the population in 2008 and 2010.
We investigated the number of the same place Rana uenoi in the same place.

I feel right.
Certainly ... The population of Rana uenoi seems to be declining ...

I have done similar research in the same time period in 2016 in San Sali ....

https://cafe.naver.com/yangpakor/30240

There is not much difference from the result now.

In 2018, about a quarter of the population is likely to be compared to 2008.
In Seosan, Chungnam Province.

https://cafe.naver.com/yangpakor/33521

Posted on November 18, 2018 10:16 by pintail pintail | 1 observation | 0 comments | Leave a comment

November 17, 2018

What is the distribution of Rana dybowskii and Rana uenoi? North Korea has the answer.

What is the distribution of Rana dybowskii and Rana uenoi? North Korea has the answer.

https://cafe.naver.com/yangpakor/33443

The distribution of Rana dybowskii, Rana uenoi and Rana huanrensis recorded in the inaturalist, Rana huanrenensis seems to be distributed from China to Korea including North Korea. It is expected that Rana uenoi will spread from Tsushima, Jeju Island, Japan, South Korea to the central and southern regions of North Korea. Rana dybowskii is probably not expected to extend to the northern part of North Korea, and it is worth investigating how Baekdu Mountain forms the boundary.

https://www.inaturalist.org/journal/pintail/5235-south-korea-rana-uenoi-rana-huanrensis-rana-coreana
https://cafe.naver.com/yangpakor/32192

In the above two articles, we are talking about the distribution of Rana dybowskii and Rana uenoi.
What effect did Paekdusan have on the distribution of Rana dybowskii?

Posted on November 17, 2018 13:02 by pintail pintail | 0 comments | Leave a comment

April 24, 2018

It seems that Gloydius Tsushimaensis lives not only in Japan Tsushima but also in Jeju and southern parts of Korea.

It seems that Gloydius Tsushimaensis lives not only in Japan Tsushima but also in Jeju and southern parts of Korea.

MtDNA of individuals collected in Jeju and Sacheon in Korea were similar to those of Gloydius tsushimaensis in NCBI.

I think there is a possibility that it is widely distributed in South Jeolla Province and South Gyeongsang Province which are southern part of Korea.

http://cafe.naver.com/yangpakor/32397

Posted on April 24, 2018 03:02 by pintail pintail | 2 comments | Leave a comment

April 01, 2018

Hynobius's distribution

It publishes the distribution of eight species of Hynobius salamander in South Korea.
I can't paste the picture file, so I upload the link I've posted.
http://cafe.naver.com/yangpakor/32285

Posted on April 01, 2018 12:48 by pintail pintail | 1 observation | 0 comments | Leave a comment

Hynobius of South Korea

Hynobius, a South Korean habitat, is not easy to distinguish species by their outer form. You may be able to see the teeth of the palate by dissection, but salamanders die.
The best way is to analyze the mitochondrial DNA. Currently, four species have Korean names and the other four have not yet been named. HC1, HC3 was first released in 2008 by Baek Hye-jun. Below are the eight Hynobius Salamander DNA sequences.

hynobius_leechii
GCCGGGATAGTGGGCACCGCCTTAAGTCTCTTAATTCGAGCTGAGTTAAGCCAACCCGGGACTCTTCTT
GGAGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATACC
AGTAATAATTGGGGGTTTTGGAAATTGACTAGTTCCATTAATAATCGGCGCCCCGGATATAGCATTTCCA
CGAATAAATAATATAAGTTTTTGGTTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
GGCCGGAGCAGGGACAGGCTGAACCGTTTATCCACCATTAGCGGGTAACTTAGCACATGCCGGGGCTT
CGGTTGATTTAACAATTTTTTCGCTACATTTAGCAGGTATTTCATCAATTCTAGGAGCAATTAACTTTATT
ACAACTTCCATTAATATAAAACCCTCGTCGATATCGCAGTATCAAACACCCTTATTTGTATGATCTGTGTT
AATTACTGCTATTCTTCTTTTACTATCTTTACCAGTCCTTGCCGCAGGGATTACAATACTTCTAACAGACC
GAAACCTAAACACTACATTCTTCGACCCTGCGGGGGGAGGTGACCCTGTTCTTTACCAGCACTTGTTTT
GATTTTTTGGTCATCCAGAGGTTTAT

Hynobius_yangiI
GCCGGAATAGTGGGTACCGCCCTAAGTCTCCTAATTCGAGCTGAATTAAGCCAACCCGGAACTCTCCTT
GGGGATGACCAGATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATACC
AGTAATAATTGGGGGCTTCGGAAATTGGTTGGTGCCATTAATAATCGGCGCCCCAGATATAGCATTTCCG
CGAATAAATAATATAAGTTTTTGACTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
GGCCGGAGCAGGAACAGGCTGGACCGTCTATCCACCATTAGCAAGTAACTTAGCACATGCTGGAGCCT
CAGTTGATTTAACAATTTTTTCACTGCATTTAGCAGGTATTTCATCAATTCTAGGAGCAATTAACTTTATC
ACAACTTCCATTAATATAAAACCCTCCTCAATATCACAATACCAAACACCCTTATTTGTCTGATCTGTATT
AATTACTGCTATTCTTCTTTTATTATCTTTACCAGTCCTTGCTGCAGGGATCACAATACTTCTAACAGACC
GAAACCTAAACACTACATTCTTCGACCCCGCAGGTGGAGGTGACCCTGTTCTCTACCAACACTTATTTT
GATTTTTTGGTCACCCAGAGGTTTAT

Hynobius_quelpaertensis
GCTGGGATAGTTGGCACTGCCTTAAGTCTCCTAATTCGAGCCGAACTAAGCCAGCCTGGGACTCTTCTC
GGGGATGACCAGATTTATAATGTGATTGTAACTGCTCACGCATTTGTAATAATTTTTTTTATGGTAATGCC
AGTGATAATCGGGGGCTTCGGAAATTGGTTAGTCCCATTAATAATCGGCGCCCCGGACATAGCATTTCC
ACGAATAAATAACATAAGTTTTTGGCTATTACCCCCGTCATTTCTTTTATTACTAGCATCATCTGGGGTTG
AAGCTGGAGCAGGAACAGGCTGAACCGTTTATCCCCCACTAGCAGGTAACTTAGCACATGCTGGAGCT
TCAGTTGATTTAACAATTTTTTCACTACACTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTAT
TACAACCTCCATTAATATAAAACCCCTATCAATATCCCAATATCAAACACCTTTATTTGTTTGATCCGTATT
AATTACTGCTATTCTTCTTTTATTATCTTTACCAGTCCTTGCCGCAGGAATCACAATACTCCTAACAGACC
GAAACCTAAATACTACATTCTTCGACCCTGCAGGAGGAGGTGATCCCGTTCTCTATCAACATTTATTTTG
ATTTTTTGGTCACCCAGAGGTCTAT

HC1
GCTGGGATAGTGGGCACTGCCCTAAGTCTCCTAATTCGAGCTGAATTAAGCCAACCCGGAACTCTTCTC
GGAGATGACCAAATTTATAATGTAATTGTAACTGCTCACGCATTCGTAATAATTTTTTTTATAGTAATGCC
AGTAATAATTGGAGGTTTTGGAAATTGGTTGGTTCCATTAATAATTGGTGCCCCAGACATAGCATTCCCG
CGAATAAATAACATAAGTTTTTGGCTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
AGCCGGAGCAGGAACAGGCTGAACCGTTTACCCCCCACTGGCAGGTAACTTAGCACATGCTGGAGCCT
CAGTTGATTTAACAATTTTCTCACTACACTTAGCAGGTATTTCATCAATTTTAGGAGCAATTAATTTTATT
ACAACCTCTATTAATATAAAACCCTTGTCAATATCGCAATACCAAACACCTTTATTTGTTTGATCAGTACT
AATCACTGCTATTCTTCTTTTACTGTCTTTACCAGTCCTTGCCGCAGGGATTACAATACTTCTGACAGAC
CGAAACCTAAATACTACATTCTTCGACCCAGCGGGGGGAGGTGATCCTGTTCTCTATCAACACTTGTTT
TGATTTTTTGGTCACCCAGAGGTCTAT

Hynobius_unisacculus_HC2
GCCGGAATGGTGGGCACTGCCTTGAGTCTCCTAATTCGAGCTGAATTAAGCCAACCCGGATCTCTTCTC
GGTGATGACCAAATTTATAATGTAATTGTAACTGCTCACGCATTCGTAATAATTTTTTTTATGGTAATACC
AGTAATAATTGGGGGTTTCGGAAATTGATTAGTTCCATTAATAATTGGTGCCCCGGACATAGCATTTCCC
CGAATAAATAATATAAGTTTTTGGCTATTACCCCCATCATTTCTTTTATTACTAGCATCATCCGGGGTTGA
AGCTGGAGCAGGAACAGGCTGAACCGTTTACCCCCCACTGGCAGGTAACTTAGCACATGCTGGAGCCT
CAGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAATTTTATT
ACAACCTCCATTAATATAAAACCCCTGTCAATATCGCAGTACCAGACACCTCTGTTTGTTTGATCAGTATT
AATTACTGCTATTCTTCTTTTACTATCTTTACCAGTCCTTGCCGCAGGGATTACAATACTTCTAACAGACC
GAAACCTAAATACTACATTCTTCGACCCGGCGGGGGGAGGTGACCCTGTTCTCTATCAACATTTATTTTG
ATTTTTTGGCCACCCTGAGGTTTAT

HC3
GCCGGGATAGTGGGCACCGCCCTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGAACCCTTCTT
GGGGATGATCAAATTTATAACGTAATTGTGACCGCCCACGCATTTGTGATAATCTTTTTTATAGTAATACC
AGTAATAATTGGAGGCTTCGGGAATTGGTTAGTTCCATTAATAATTGGCGCCCCAGATATAGCATTTCCA
CGAATAAACAATATAAGTTTTTGACTATTACCCCCATCATTTCTCTTATTACTAGCATCATCCGGGGTTGA
AGCTGGGGCGGGAACAGGCTGAACCGTTTATCCGCCCCTGGCAGGTAATTTAGCACATGCCGGAGCCT
CAGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCGTCAATTCTAGGGGCAATTAACTTTATT
ACAACTTCCATTAATATAAAACCCTCATCAATATCGCAATATCAAACACCCTTATTTGTTTGATCTGTATT
AATTACTGCTATCCTTCTTTTACTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACC
GAAACCTAAATACTACCTTCTTCGACCCCGCAGGGGGAGGCGACCCCGTTCTCTACCAACACCTATTTT
GATTTTTTGGTCACCCAGAGGTTTAT

HC4_Changwon
GCCGGAATAGTGGGCACTGCCCTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACCCTCCTC
GGTGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATCTTTTTTATAGTAATACCA
GTAATAATTGGGGGTTTCGGAAATTGGTTAGTTCCGTTAATAATTGGCGCCCCAGATATGGCATTTCCAC
GAATAAATAATATAAGTTTCTGATTATTACCCCCATCATTTCTTTTACTATTAGCATCATCCGGAGTTGAG
GCTGGAGCAGGAACAGGCTGAACCGTTTACCCACCACTAGCGGGTAACTTGGCACATGCCGGAGCCT
CGGTTGATTTAACAATTTTTTCGTTGCATTTAGCAGGTATCTCATCAATTCTAGGAGCAATTAACTTCATC
ACAACCTCCATTAACATAAAACCCTCATCAATATCGCAATATCAAACACCCTTATTTGTCTGATCTGTACT
AATTACTGCTATCCTTCTTTTACTGTCTTTACCAGTTCTTGCCGCAGGAATTACAATACTTCTAACAGACC
GGAACCTAAATACCACATTCTTCGACCCTGCAGGGGGAGGTGACCCTGTTCTCTACCAACACTTGTTTT
GATTTTTTGGCCACCCAGAGGTTTAT

HC5_BoSung
AGCTGGATAGTAGGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTT
GGGGATGATCAAATTTATAATGTAATTATAACTGCTCACGCATTTGTAATAATTTTTTTTATAGTAATACA
AGTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCC
GCGAATGAATAACATAAGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTG
AAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGC
CTCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTA
TTACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTAT
TAATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGAC
CGAAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGGGACCCTGTTCTCTACCAACACTTGTTT
TGATTTTTTGGTCACCCTGAAGTTTAA

HC5_YoungAm
CCCTGGATAGTAGGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTT
GGGGATGATCACATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATATTTTTTTTTATAGTAATACCA
GTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCCG
CGAATGAATAACATAAGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTGA
AGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGCC
TCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTAT
TACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTATT
AATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGACC
GAAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGGGACCCTGTTCTCTACCAACACTTGTTTT
GATTTTTTGGTCACCCTGAAGTTTAA

HC5_GoHeung
CGCTGGAAAGTAGGCACTGCTTTAAGTCTTCTAATTCGAGCTGAATTAAGCCAACCCGGGACTCTTCTT
GGGGATGATCAAATTTATAATGTAATTGTAACTGCTCACGCATTTGTAATAATTTTTTTTATAGTAATACC
AGTAATAATCGGAGGTTTTGGAAACTGGTTAGTTCCGTTAATAATCGGCGCCCCAGACATAGCATTCCC
GCGAATGAATAACATACGTTTTTGACTATTACCACCATCATTTCTTTTATTATTAGCATCATCCGGGGTTG
AAGCTGGGGCAGGAACAGGCTGAACCGTTTACCCCCCACTAGCAGGCAACTTAGCACATGCCGGAGC
CTCGGTTGATTTAACAATTTTTTCACTACATTTAGCAGGTATTTCATCAATTCTAGGGGCAATTAACTTTA
TTACAACCTCCATTAATATAAAACCATTATCGATATCGCAATATCAAACACCTCTATTTGTTTGATCAGTAT
TAATTACTGCTATTCTTCTCTTATTATCTTTACCGGTCCTTGCCGCAGGAATTACAATACTTCTAACAGAC
CGAAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGGGACCCTGTTCTCTACCAACACTTGTTT
TGATTTTTTGGTCACCCTGAAGTTTAA

Posted on April 01, 2018 12:38 by pintail pintail | 0 comments | Leave a comment

March 19, 2018

Rana kukunoris and Rana chensinensis 2....

http://cafe.naver.com/yangpakor/32180

Interesting.
Chinese scholars will have an answer in the next 2-3 years.

Rana chensinensis and Rana kukunoris seem to be the final challenge of Rana frogs living in Northeast Asia.

There are three cases below.

The present situation seems to be the situation of (A)
I wonder if (B) is the answer
Or, as in (C), there may be a case of subdividing the species.

What do you think?

In the northern part of North Korea, Rana dybowskii, Rana chensinensis and Rana kukunoris are also likely to live.
All three species of Chinese Yanbian around the Yalu River, including Rana amurensis.

http://cafe.naver.com/yangpakor/32180

Posted on March 19, 2018 03:14 by pintail pintail | 0 comments | Leave a comment

March 18, 2018

Rana kukunoris and Rana chensinensis

The last problem of Rana frogs in Northeast Asia is to distinguish Rana chensinensis from Rana kukunoris.
Rana kukunoris, who recently appeared on NCBI, seems to have a rough answer.
Rana kukunoris is widely distributed in China Jirin and seems to have a lot of variety.

http://cafe.naver.com/yangpakor/32177

Posted on March 18, 2018 13:02 by pintail pintail | 2 comments | Leave a comment

January 29, 2017

The distinction between Rana chensinensis and Rana kukunoris is the most difficult.

http://cafe.naver.com/yangpakor/30389

The distinction between Rana chensinensis and Rana kukunoris is the most difficult.
A detailed examination of Rana chensinensis and Rana kukunorisis.
If the group closest to Rana huanrensis is Rana chensinensis, then the next group may be called Rana kukunoris, but I think we can see all as one species.

Once this is done, the frog of the Rana genus in Northeast Asia seems to be theorized.

And I have questions.
Where is the north end of Uenoi?
Is not Rana chensinensis living in the west and south of Rana huanrensis?

http://cafe.naver.com/yangpakor/30389

Posted on January 29, 2017 09:00 by pintail pintail | 8 observations | 0 comments | Leave a comment